Basic Process for Designing Primers for Cloning
- Locate your template
- For example, suppose we want to clone the sequence for pLtetO: tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc
- Design a forward primer with the basic structure 5' BUFFER NUCLEOTIDES - RESTRICTION SITE - TEMPLATE ANNEALING PORTION 3'
- TEMPLATE ANNEALING PORTION
- Since this the forward primer, simply select the 5' nucleotides of the template. For example, tccctatcagtgatagagattgacatc in the pLtetO example.
- Use a melting temperature calculator to determine the Nearest Neighbor melting temperature (TmNN). There are different ways of calculating melting temperatures but this is often the most accurate. I like to use http://www.basic.northwestern.edu/biotools/oligocalc.html. For example, tccctatcagtgatagagattgacatc in the pLtetO example has a TmNN of 56.23C.
- Aim for TmNN of >= 50C. The more bases you choose for this portion, the greater the TmNN will be. I usually go from 50-53C and not higher, since it is often not necessary and just adds more cost and complexity to oligo synthesis.
- That being said, in the pLtetO example above, we selected a longer template annealing portion with a higher TmNN because there is an internal repeat in the pLtetO sequence (see the two bolded and underlined regions which are exactly the same in the sequence tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc). Thus, in order to get specific binding of the primer to the template, we want additional length to the primer. Remember that PCR extension occurs at the 3' end of the primer. Thus, we want to ensure that there is no nonspecific binding at the 3' end of your designed primer. Thus, we designed our template annealing portion to include additional base pairs so that the 3' end of the template annealing portion can only bind in one way to the template.
- RESTRICTION SITE
- Check the NEB website (http://www.neb.com) for your restriction site sequence. For example, MluI is ACGCGT. Note that many restriction sites are palindromes.
- Check your template and the vector you will be cloning into to make sure that it does not contain the restriction site that you want. You can do this using many different programs. One good web-based tool is http://tools.neb.com/NEBcutter2/index.php
- BUFFER NUCLEOTIDES
- These are nucleotides that must be added upstream (to the 5' end of the restriction site) for efficient cleavage. NEB has information on how many upstream sites you need to add for efficient cleavage, which you can find at http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp and http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucleotides.asp. The first link is often more accurate because it describes the case where you have a restriction enzyme at the 5' end of a relatively long piece of DNA. However, in some cases where you are cutting short DNA such as oligos, the second link may be more accurate. For example, the NEB Website states that MluI is cleaved with 99% efficiency with 2 BUFFER NUCLEOTIDES (let's choose 5' CT 3' randomly for our BUFFER NUCLEOTIDES).
- By default, if you don't find information on the links above, you should select about 6 nucleotides for your BUFFER NUCLEOTIDES.
- ASSEMBLE AND NAME THE SEQUENCE
- For example, for MluI-pLtetO-f, we assemble 5' CT ACGCGT tccctatcagtgatagagattgacatc 3'
- Calculate the total TmNN of the entire primer. In this case, it is 65C.
- Record the TmNN of the total primer and the TmNN of the TEMPLATE ANNEALING PORTION (e.g., TmNN 65/56)
- Choose a descriptive name for the primer. I like the convention of listing the restriction enzyme names, the template names, and the direction. For example, MluI-pLtetO-f states that this primer contains (from 5' to 3'), an MluI RESTRICTION SITE followed by a TEMPLATE ANNEALING PORTION which is in the forward direction of the template.
- So I would record this primer as 5' CT ACGCGT tccctatcagtgatagagattgacatc 3' MluI-pLtetO-f TmNN 65/56.
- TEMPLATE ANNEALING PORTION